concentration in idte Search Results


94
Integrated DNA Technologies antisense oligo
Antisense Oligo, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Antisense+Oligos/pmc04949451-93-51-12
Average 94 stars, based on 1 article reviews
antisense oligo - by Bioz Stars, 2026-10
94/100 stars
  Buy from Supplier

95
Danaher Inc r crispr cas9 crrnas
R Crispr Cas9 Crrnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Alt-R+CRISPR-Cas9+Negative+Control+crRNA/pmc08134429-162-20-46
Average 95 stars, based on 1 article reviews
r crispr cas9 crrnas - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

96
Danaher Inc cas9
( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with <t>Cas9</t> assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.
Cas9, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Alt-R+S%2Ep%2E+Cas9+Nuclease+V3/bio_rxiv__2022__03__31__486495-250-16-17
Average 96 stars, based on 1 article reviews
cas9 - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
New England Biolabs sgrna
( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with <t>Cas9</t> assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.
Sgrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Cas9+Nuclease/pmc08496789-238-37-41
Average 96 stars, based on 1 article reviews
sgrna - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

97
Integrated DNA Technologies oligonucleotide strands
( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with <t>Cas9</t> assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.
Oligonucleotide Strands, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/DNA+oligo/pmc09300469-142-13-15
Average 97 stars, based on 1 article reviews
oligonucleotide strands - by Bioz Stars, 2026-10
97/100 stars
  Buy from Supplier

99
Integrated DNA Technologies cas9 nls
Sequences used for <t> CRISPR/Cas9, </t> MosSCI, cloning and diagnosis. Table of the DNA/RNA sequences used for construction of the strains in this manuscript
Cas9 Nls, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Cas9+Nuclease/pmc06553534-47-17-23
Average 99 stars, based on 1 article reviews
cas9 nls - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

98
Integrated DNA Technologies crrna tracrrna duplex
Sequences used for <t> CRISPR/Cas9, </t> MosSCI, cloning and diagnosis. Table of the DNA/RNA sequences used for construction of the strains in this manuscript
Crrna Tracrrna Duplex, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/tracrRNA/pmc09073554-39-25-11
Average 98 stars, based on 1 article reviews
crrna tracrrna duplex - by Bioz Stars, 2026-10
98/100 stars
  Buy from Supplier

99
New England Biolabs rpa primers
Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with <t>RPA</t> primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation <t>of</t> <t>Cas12a</t> to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.
Rpa Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/NEBuffer+r2%2E1/pm36973334-154-12-9
Average 99 stars, based on 1 article reviews
rpa primers - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

96
New England Biolabs template switching oligo
Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with <t>RPA</t> primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation <t>of</t> <t>Cas12a</t> to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.
Template Switching Oligo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Template+Switching+RT+Enzyme+Mix/bio_rxiv__2023__06__28__546392-258-18-38
Average 96 stars, based on 1 article reviews
template switching oligo - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

99
New England Biolabs flua fw aaggctgggcctttgacgat flua rev aggtgtggaccaaccaccaa flua probe
Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with <t>RPA</t> primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation <t>of</t> <t>Cas12a</t> to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.
Flua Fw Aaggctgggcctttgacgat Flua Rev Aggtgtggaccaaccaccaa Flua Probe, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/M-MuLV+Reverse+Transcriptase/10__1016_slash_j__ejmech__2013__10__063-272-16-33
Average 99 stars, based on 1 article reviews
flua fw aaggctgggcctttgacgat flua rev aggtgtggaccaaccaccaa flua probe - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier

95
Integrated DNA Technologies analyzedwith themismatch detection assay surveyor e3 cell metabolism 25
Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with <t>RPA</t> primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation <t>of</t> <t>Cas12a</t> to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.
Analyzedwith Themismatch Detection Assay Surveyor E3 Cell Metabolism 25, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/Surveyor+Mutation+Detection+Kit/pm28380382-146-8-24
Average 95 stars, based on 1 article reviews
analyzedwith themismatch detection assay surveyor e3 cell metabolism 25 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

90
IDT Biologika dmlt
Adverse events (AE) possibly, probably, or definitely related to vaccine, through Day 28 post-vaccination.
Dmlt, supplied by IDT Biologika, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/concentration+in+idte/dmlt/pmc09024222-88-108-47
Average 90 stars, based on 1 article reviews
dmlt - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

Image Search Results


( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with Cas9 assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.

Journal: bioRxiv

Article Title: CIS calibrates GM-CSF signalling strength to regulate macrophage polarization via a STAT5-IRF8 axis

doi: 10.1101/2022.03.31.486495

Figure Lengend Snippet: ( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with Cas9 assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.

Article Snippet: CIS RNPs were assembled by incubating 1ml of 30mM CIS sgRNA (5’-CTCACCAGATTCCCGAAGGT-3’; Synthego), 1.7ml of 67nM Cas9 (Integrated DNA Technologies #1081058), 1ml of electroporation enhancer (Integrated DNA Technologies #1075915) and 1.3ml PBS for 10min at room temperature.

Techniques: Comparison, Derivative Assay, Concentration Assay, Transfection, Cell Culture

Sequences used for  CRISPR/Cas9,  MosSCI, cloning and diagnosis. Table of the DNA/RNA sequences used for construction of the strains in this manuscript

Journal: G3: Genes|Genomes|Genetics

Article Title: Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline

doi: 10.1534/g3.119.400162

Figure Lengend Snippet: Sequences used for CRISPR/Cas9, MosSCI, cloning and diagnosis. Table of the DNA/RNA sequences used for construction of the strains in this manuscript

Article Snippet: Ultramer oligonucleotides, tracrRNA, and crRNAs were obtained from IDT and mixed in the following concentrations: 14.35 µM Cas9-NLS (Berkeley MacroLab), 17.6 µM tracrRNA (IDT), 1.5 µM dpy10 crRNA (IDT), 5 µM dpy10 ssODN (IDT), 16.2 µM of target crRNA (IDT), and 6 µM of target ssODN (IDT) (see ).

Techniques: CRISPR, Clone Assay, Sequencing

Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with RPA primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation of Cas12a to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.

Journal: Scientific reports

Article Title: CRISPR-assisted test for Schistosoma haematobium.

doi: 10.1038/s41598-023-31238-y

Figure Lengend Snippet: Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with RPA primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation of Cas12a to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.

Article Snippet: Cas12a was diluted to its final concentration in 10X NEBuffer r2.1. crRNAs, RPA primers, synthetic target DNA and ssDNA-FQ were synthesised by Integrated DNA Technologies.

Techniques: Amplification, Fluorescence, Concentration Assay, Comparison, Standard Deviation

Adverse events (AE) possibly, probably, or definitely related to vaccine, through Day 28 post-vaccination.

Journal: Vaccine

Article Title: Intradermal fractional-dose inactivated polio vaccine (fIPV) adjuvanted with double mutant Enterotoxigenic Escherichia coli heat labile toxin (dmLT) is well-tolerated and augments a systemic immune response to all three poliovirus serotypes in a randomized placebo-controlled trial

doi: 10.1016/j.vaccine.2022.03.056

Figure Lengend Snippet: Adverse events (AE) possibly, probably, or definitely related to vaccine, through Day 28 post-vaccination.

Article Snippet: Additionally, preclinical and clinical work assessing the use of dmLT as an injectable adjuvant for Enterotoxigenic Escherichia coli (ETEC) vaccines has similarly found doses of 0.5 μg to be immunogenic with limited local reactogenicity , . dmLT was produced according to good manufacture practice (GMP) specification by IDT Biologika Corporation and supplied by PATH in the form of 500 μg lyophilized cake in 3 mL vials (lot 001-0816) and maintained at −20 °C during transport and storage at the clinical site for up to 12 months prior to use. dmLT was rehydrated with 0.5 mL of sterile water for injection to achieve a final concentration of 1 mg/ml dmLT.

Techniques: Injection