|
Integrated DNA Technologies
antisense oligo Antisense Oligo, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Antisense+Oligos/pmc04949451-93-51-12 Average 94 stars, based on 1 article reviews
antisense oligo - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Danaher Inc
r crispr cas9 crrnas R Crispr Cas9 Crrnas, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Alt-R+CRISPR-Cas9+Negative+Control+crRNA/pmc08134429-162-20-46 Average 95 stars, based on 1 article reviews
r crispr cas9 crrnas - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
Danaher Inc
cas9 ![]() Cas9, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Alt-R+S%2Ep%2E+Cas9+Nuclease+V3/bio_rxiv__2022__03__31__486495-250-16-17 Average 96 stars, based on 1 article reviews
cas9 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
sgrna ![]() Sgrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Cas9+Nuclease/pmc08496789-238-37-41 Average 96 stars, based on 1 article reviews
sgrna - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
oligonucleotide strands ![]() Oligonucleotide Strands, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/DNA+oligo/pmc09300469-142-13-15 Average 97 stars, based on 1 article reviews
oligonucleotide strands - by Bioz Stars,
2026-10
97/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
cas9 nls ![]() Cas9 Nls, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Cas9+Nuclease/pmc06553534-47-17-23 Average 99 stars, based on 1 article reviews
cas9 nls - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
crrna tracrrna duplex ![]() Crrna Tracrrna Duplex, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/tracrRNA/pmc09073554-39-25-11 Average 98 stars, based on 1 article reviews
crrna tracrrna duplex - by Bioz Stars,
2026-10
98/100 stars
|
Buy from Supplier |
|
New England Biolabs
rpa primers ![]() Rpa Primers, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/NEBuffer+r2%2E1/pm36973334-154-12-9 Average 99 stars, based on 1 article reviews
rpa primers - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
template switching oligo ![]() Template Switching Oligo, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Template+Switching+RT+Enzyme+Mix/bio_rxiv__2023__06__28__546392-258-18-38 Average 96 stars, based on 1 article reviews
template switching oligo - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
|
New England Biolabs
flua fw aaggctgggcctttgacgat flua rev aggtgtggaccaaccaccaa flua probe ![]() Flua Fw Aaggctgggcctttgacgat Flua Rev Aggtgtggaccaaccaccaa Flua Probe, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/M-MuLV+Reverse+Transcriptase/10__1016_slash_j__ejmech__2013__10__063-272-16-33 Average 99 stars, based on 1 article reviews
flua fw aaggctgggcctttgacgat flua rev aggtgtggaccaaccaccaa flua probe - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
|
Integrated DNA Technologies
analyzedwith themismatch detection assay surveyor e3 cell metabolism 25 ![]() Analyzedwith Themismatch Detection Assay Surveyor E3 Cell Metabolism 25, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/Surveyor+Mutation+Detection+Kit/pm28380382-146-8-24 Average 95 stars, based on 1 article reviews
analyzedwith themismatch detection assay surveyor e3 cell metabolism 25 - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
|
IDT Biologika
dmlt ![]() Dmlt, supplied by IDT Biologika, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/concentration+in+idte/dmlt/pmc09024222-88-108-47 Average 90 stars, based on 1 article reviews
dmlt - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: CIS calibrates GM-CSF signalling strength to regulate macrophage polarization via a STAT5-IRF8 axis
doi: 10.1101/2022.03.31.486495
Figure Lengend Snippet: ( A ) IL-12 production by WT and Cish −/− GM-MØs stimulated with GpG or LPS for 20 hrs. *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. (B ) Production of IL-12 by WT (Ly5.1) and Cish −/− (Ly5.2) GM-MØs derived from co-cultures with BM cells from individual mice. Harvested cells were stimulated with CpG for 4 hrs. ***P<0.001 by t test. ( C ) IL-12 production by spleen cells from WT and Cish −/− mice. Mice were engrafted with B16-GM for 9 days. Spleen cells were stimulated with CpG or LPS for 20 hrs. Bar graphs show mean ± SD of IL-12 concentration in culture supernatants. *P<0.05, **P<0.01 by t test. ( D ) IL-12 production by spleen MØs of WT and Cish −/− mice. Mix bone marrow chimera mice reconstituted with both WT (Ly5.1) and Cish −/− (Ly5.2) BM cells were engrafted with B16-GM for 9 days. Sorted MØs were stimulated with CpG for 20 hrs. Line graphs show IL-12 production by paired spleen MØs of WT and Cish −/− mice from the same hosts. *P<0.05, **P<0.01 by t test. ( E&F ) IL-12 production by human GM-MØs with Cish deletion. Human cord blood CD34 + cells were transfected with Cas9 assemble RNP and Cish guide RNA. Transfected CD34 + cells were cultured with human GM-CSF (5 ng/ml) for 7 days. Cells were stimulated with CpG or LPS. FACS plots show resulted human GM-MØ population ( E ). Bar graphs show IL-12 production by human GM-MØs ( F ). *P<0.05, **P<0.01 by multiple group comparison of ANOVA test. Data are representative of three independent experiments.
Article Snippet: CIS RNPs were assembled by incubating 1ml of 30mM CIS sgRNA (5’-CTCACCAGATTCCCGAAGGT-3’; Synthego), 1.7ml of 67nM
Techniques: Comparison, Derivative Assay, Concentration Assay, Transfection, Cell Culture
Journal: G3: Genes|Genomes|Genetics
Article Title: Tissue-Specific Split sfGFP System for Streamlined Expression of GFP Tagged Proteins in the Caenorhabditis elegans Germline
doi: 10.1534/g3.119.400162
Figure Lengend Snippet: Sequences used for CRISPR/Cas9, MosSCI, cloning and diagnosis. Table of the DNA/RNA sequences used for construction of the strains in this manuscript
Article Snippet: Ultramer oligonucleotides, tracrRNA, and crRNAs were obtained from IDT and mixed in the following concentrations: 14.35 µM
Techniques: CRISPR, Clone Assay, Sequencing
Journal: Scientific reports
Article Title: CRISPR-assisted test for Schistosoma haematobium.
doi: 10.1038/s41598-023-31238-y
Figure Lengend Snippet: Figure 1. CATSH design and optimisation. (a) Visualisation of the targeted S. haematobium Dra1 repeat region with RPA primers, amplicon and crRNAs. (b) Schematic of the proposed CATSH workflow. Preparation of urine samples with in-house CATSH-compatible protocol, followed by CATSH testing. Real-time fluorescence is recorded on a portable reader. (c) Optimisation of ssDNA-FQ concentration. (d) Comparison of three crRNAs. (e) Optimisation of RPA input. (f) Optimisation of Cas12a to crRNA ratio. All reactions were run in five repeats. Bars represent the average endpoint fluorescence after background subtraction and error bars represent the standard deviation between repeats.
Article Snippet: Cas12a was diluted to its final concentration in 10X
Techniques: Amplification, Fluorescence, Concentration Assay, Comparison, Standard Deviation
Journal: Vaccine
Article Title: Intradermal fractional-dose inactivated polio vaccine (fIPV) adjuvanted with double mutant Enterotoxigenic Escherichia coli heat labile toxin (dmLT) is well-tolerated and augments a systemic immune response to all three poliovirus serotypes in a randomized placebo-controlled trial
doi: 10.1016/j.vaccine.2022.03.056
Figure Lengend Snippet: Adverse events (AE) possibly, probably, or definitely related to vaccine, through Day 28 post-vaccination.
Article Snippet: Additionally, preclinical and clinical work assessing the use of
Techniques: Injection